View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4189_low_23 (Length: 205)
Name: NF4189_low_23
Description: NF4189
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4189_low_23 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 159; Significance: 7e-85; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 1 - 191
Target Start/End: Original strand, 20096564 - 20096749
Alignment:
| Q |
1 |
gcatattttaatcttaatatgtaatgaatatcagatatagggcgtgtgatagtgaaaacatgtgtttcttgtgttgcaattgatcacatcttaggtaaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
20096564 |
gcatattttaatcttaatatgtaatgaatatcagatatagtgcgtgtaatagtgaaaacatgtgtttcttgtgttgcaattgatcacatcttcggtaaac |
20096663 |
T |
 |
| Q |
101 |
atattttaatctcaacaagtaatgaatatcagattttccaaaataaagaaaagggtcacgatcgtgtcttgctttatttttattcctttct |
191 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20096664 |
atattttaatctcaacaagtaatgaat-----attttccaaaataaagaaaagggtcacgatcgtgtcttgctttatttttattcctttct |
20096749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 62; E-Value: 5e-27
Query Start/End: Original strand, 36 - 134
Target Start/End: Original strand, 20096499 - 20096599
Alignment:
| Q |
36 |
tatagggcgtgtgatagtgaaaacatgtgtttcttgtg--ttgcaattgatcacatcttaggtaaacatattttaatctcaacaagtaatgaatatcaga |
133 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||||||| |||||||||||||| |||||||||| ||||||||||||| || | ||||||||||||||| |
|
|
| T |
20096499 |
tatagtgcgtgtgataatgaaaacatgtgtttcttgtgtgttgcaattgatcacgtcttaggtaagcatattttaatcttaatatgtaatgaatatcaga |
20096598 |
T |
 |
| Q |
134 |
t |
134 |
Q |
| |
|
| |
|
|
| T |
20096599 |
t |
20096599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 145 - 191
Target Start/End: Complemental strand, 19884007 - 19883961
Alignment:
| Q |
145 |
aaagaaaagggtcacgatcgtgtcttgctttatttttattcctttct |
191 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
19884007 |
aaagcaaaggatcacgatcgtgtcttgctttatttttattcctttct |
19883961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University