View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4189_low_7 (Length: 356)
Name: NF4189_low_7
Description: NF4189
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4189_low_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 138; Significance: 4e-72; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 23 - 179
Target Start/End: Original strand, 44708453 - 44708610
Alignment:
| Q |
23 |
tgttaatgaatgaatacaaaaacaaggaagggtattctggtaatttgaaaaatggaatatgattcttctcgtgagtagaataacgcagagttcgcgcttt |
122 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44708453 |
tgttaatgaatgaatacaaaaacagggaagggtattctggtaatttgaaaaatggaatatgattcttctcgtgagtagaataacgcagagttcgcgcttt |
44708552 |
T |
|
| Q |
123 |
cagatttacgttagtgcatccaaactaactcaa-ctgtccttctttgtcccacttcat |
179 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
44708553 |
cagatttgcgttagtgcatccaaactaactcaaccggtccttctttgtcccacttcat |
44708610 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 227 - 346
Target Start/End: Original strand, 44708658 - 44708778
Alignment:
| Q |
227 |
ctcctacggtatcctt-tgacgcccttgaatacacttattttataatcggaagtgcatgtatttgacttttttagattgttatagactttgaactataca |
325 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
44708658 |
ctcccacggtatccttgtgacgcccttgaatacacttattttataatcggaagtgcatgtatttgacttttttagattgttatagacttcgagctataca |
44708757 |
T |
|
| Q |
326 |
tctctctttttcgaccctttg |
346 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
44708758 |
tctctctttttcgaccttttg |
44708778 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University