View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4189_low_8 (Length: 309)
Name: NF4189_low_8
Description: NF4189
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4189_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 18 - 272
Target Start/End: Original strand, 43069031 - 43069287
Alignment:
| Q |
18 |
aaacccacttcacgctatttccatttgctaaattaattgatag--taattaaagattgaatattgatgaaactcactttacctctactcgcagttgaacc |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
43069031 |
aaacccacttcacgctatttccatttgctaaattaattgatagagtacttaaagattgaatattgatgaaactgactttacctctactcgcagttgaacc |
43069130 |
T |
 |
| Q |
116 |
tttaaacgaatcttcatctgtgttatcaatttacaaaggataaatatatgtttagatatgtggagaaatgctactttgaagaatatgaagcatgaatcac |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43069131 |
tttaaacgaatcttcatctgtgttatcaatttacaaaggataaatatatgtttagatatgtggagaaatgctactttggagaatatgaagcatgaatcac |
43069230 |
T |
 |
| Q |
216 |
ttttttcattaattttttagaaaataatcactttgttattaaaggatttaaaatttg |
272 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43069231 |
tttttttattaattttttagaaaataatcactttgttattaaaggatttaaaatttg |
43069287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University