View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4189_low_9 (Length: 306)
Name: NF4189_low_9
Description: NF4189
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4189_low_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 3 - 290
Target Start/End: Original strand, 6740669 - 6740957
Alignment:
| Q |
3 |
taatgattagttcggttgatctcgacactattgatgtttcaaaagcgtgattaatgtatagttcctaacaacattgatctaaattctgcattttcacaac |
102 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6740669 |
taatgattagttcggttgatctcgacacttctgatgtttcaaaagcgtgattaatgtatagttcctaacaacattgatctaaattctgcattttcacaac |
6740768 |
T |
 |
| Q |
103 |
ttgcccttt-aatacttttgcgtgggaacaattgagtgatatgatgnnnnnnntctcaaattggattatctttttctttatgatgataaattctcaagtt |
201 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
6740769 |
ttgcccttttaatacttttgcgtgggaacaattgagtgatatgatgaaaaaaatctcaaattggattctctttttctttatgatgataaattctcaagtt |
6740868 |
T |
 |
| Q |
202 |
ggattctcttgccaacataggcattgtggttgtaagaggaagatgcaaccactcatatttaaaatatgagttgttcaatcccgtctaat |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6740869 |
ggattctcttgccaacataggcattgtggttgtaagaggaagatgcaaccactcatatttaaaatatgagttgttcaatcccgtctaat |
6740957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University