View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4190_low_11 (Length: 207)
Name: NF4190_low_11
Description: NF4190
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4190_low_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 121; Significance: 3e-62; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 121; E-Value: 3e-62
Query Start/End: Original strand, 17 - 195
Target Start/End: Complemental strand, 7625749 - 7625574
Alignment:
| Q |
17 |
agtatatatggcacttctatacataaaacttggtatatatgacactgacgcatacgattacannnnnnngtgtgaattagaatttataattattatattc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||| | |||||| |||||||||| |||||||||| ||||||||| |
|
|
| T |
7625749 |
agtatatatggcacttctatacataaaacttggtatatatgacagtgacgcatgcaattacattttt--gtgtgaattataatttataat-attatattc |
7625653 |
T |
|
| Q |
117 |
aataactttcattttctaaaattattatcggtgtctttgtatctgtgtcaatatcgtatctggtattcgtgtctgtgct |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
7625652 |
aataactttcattttctaaaattattatcggtgtctttgtatctgtgtcaatatcgtatctggtgttcatgtctgtgct |
7625574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 108 - 152
Target Start/End: Complemental strand, 43434557 - 43434513
Alignment:
| Q |
108 |
attatattcaataactttcattttctaaaattattatcggtgtct |
152 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
43434557 |
attatattcaatcactttcattttcttaaattattatcggtgtct |
43434513 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 108 - 173
Target Start/End: Original strand, 3497245 - 3497310
Alignment:
| Q |
108 |
attatattcaataactttcattttctaaaattattatcggtgtctttgtatctgtgtcaatatcgt |
173 |
Q |
| |
|
|||||||||||| ||||||||| | |||||||||||| ||||||| |||||| ||||| |||||| |
|
|
| T |
3497245 |
attatattcaatcactttcattatttaaaattattattggtgtctatgtatcaatgtcagtatcgt |
3497310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 108 - 151
Target Start/End: Original strand, 7250979 - 7251022
Alignment:
| Q |
108 |
attatattcaataactttcattttctaaaattattatcggtgtc |
151 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||| |||||| |
|
|
| T |
7250979 |
attatattcaattactttcattttctcaaattattattggtgtc |
7251022 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 106 - 142
Target Start/End: Original strand, 23817983 - 23818019
Alignment:
| Q |
106 |
ttattatattcaataactttcattttctaaaattatt |
142 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
23817983 |
ttattatattcaatcactttcattttcttaaattatt |
23818019 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University