View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4190_low_9 (Length: 240)
Name: NF4190_low_9
Description: NF4190
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4190_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 57 - 224
Target Start/End: Complemental strand, 41190459 - 41190294
Alignment:
| Q |
57 |
tgtgtcaaaagctttctaccacaaaaatattgactatgtgaagttagtccacttattaaggattcaannnnnnnnnnnnnnnnnngttgacatcattaag |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
41190459 |
tgtgtcaaaagctttctaccacaaaaatattgactatgtgaagttagtccacttattaaggattcaattttttttttattttt--gttgacatcattaag |
41190362 |
T |
 |
| Q |
157 |
gatttaattttgttctatgagctttgagacatttttaatcttgtatggagttaagattttcaggaatg |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41190361 |
gatttaattttgttctatgagctttgagacatttttaatcttgtatggagttaagattttcaggaatg |
41190294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 2 - 44
Target Start/End: Complemental strand, 41190497 - 41190455
Alignment:
| Q |
2 |
atcatcaggtgaattggcgttagtgatatatcctggtatgtgt |
44 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41190497 |
atcatcaggtgaattggcgttagtgatatatcctggtatgtgt |
41190455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University