View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4191_high_4 (Length: 232)
Name: NF4191_high_4
Description: NF4191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4191_high_4 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 19 - 232
Target Start/End: Original strand, 1030121 - 1030333
Alignment:
| Q |
19 |
atgttgcaccactcattacaagaaaatctactatttgacaaggaagaaatccttgagaaaagtatcgtatgaaaatccttgtgaaacaaacatttaccac |
118 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1030121 |
atgttgcaccactcactacaagaaaatctactatttgacaaagaagaaatccttgagaaaagtatcgtatgaaaatccttgtgaaacaaacatttaccac |
1030220 |
T |
|
| Q |
119 |
ggtttaaattacgatgga-agaccaaaactgacaacttttaaacataaagagattaagtccgcaaaatgnnnnnnncagggtatcgaaactacaattaaa |
217 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||| |||||||||||||||||| |||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
1030221 |
ggtttaaattacgatggatagaccaaaactaacaa-ttttaaacataaagagatcaagtccgcaaaatgaaaaaaaca-ggtatcgaaactacaattaaa |
1030318 |
T |
|
| Q |
218 |
cacttaaaattccat |
232 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
1030319 |
cacttaaaattccat |
1030333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University