View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4191_low_7 (Length: 259)
Name: NF4191_low_7
Description: NF4191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4191_low_7 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 11 - 259
Target Start/End: Complemental strand, 26672540 - 26672296
Alignment:
| Q |
11 |
cagagacagagctgaacaaaacacagtgtcggaaggaagaaggaatctaaacatccatcattttctcgtgattccctaacccatctacattctcttctct |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26672540 |
cagagacagagctgaacaaaacacagtgtcggaaggaagaaggaatctaaacatccatcattttctcgtgattccctaacccatctacattctcttctct |
26672441 |
T |
|
| Q |
111 |
tctttttattatccttcctcatacacacgcgccattctcattccacgcgccttctcttctttctttcctagctagggtttccttctctcatcatcgcaat |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
26672440 |
tctttttattatccttcctcatacacacgcgccattctcattccacgcgccttctcttctttctttc----ctagggtttccttctctcatcatcgcaat |
26672345 |
T |
|
| Q |
211 |
gtccagccccatcgatcgtttcgctcttccatgtcagttcccctctctc |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26672344 |
gtccagccccatcgatcgtttcgctcttccatgtcagttcccctctctc |
26672296 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University