View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4191_low_8 (Length: 246)
Name: NF4191_low_8
Description: NF4191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4191_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 28004429 - 28004203
Alignment:
| Q |
1 |
cttgcacaagctataagttggataacagatccaaacaaaagaaatgtgcaattaaatcccaagcccacgtttctccagtgtttccctaggagtccatcaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
28004429 |
cttgcacaagctataagttggataacagatccaaacagaagaaatgtgcaattaaatcccaagcccacgtttctccagtgtttccctaggagtccgtcaa |
28004330 |
T |
|
| Q |
101 |
gaacctcaaaccactgcatataaataatcataattaatttgtccaaccctctataatataagatgataaagtctatctttagtatcacggtagatgtatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||| ||||||||||||||||||| |
|
|
| T |
28004329 |
gaacctcaaaccactgcatataaataatcataattaatttgtccaaccctctataatataagatgataaagtttatgtttggtatcacggtagatgtatc |
28004230 |
T |
|
| Q |
201 |
agaattacgtctagttgtcgtgattct |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
28004229 |
agaattacgtctagttgtcgtgattct |
28004203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University