View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4192_high_2 (Length: 332)
Name: NF4192_high_2
Description: NF4192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4192_high_2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 1 - 322
Target Start/End: Original strand, 19074245 - 19074566
Alignment:
| Q |
1 |
atttggaattcttattcatttggtgttgtgtgaatcttgcagcacgcatcttttggttcaagaagatgtggataaggtgaatccagttgataaagaaaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19074245 |
atttggaattcttattcatttggtgttgtgtgaatcttgcagcacgcatcttttggttcaagaagatgtggataaggtgaatccagttgataaagaaaag |
19074344 |
T |
 |
| Q |
101 |
ggtgtcacacttgaggattttaagctcattaagatgcatatgtccaattgtatgtatgctcactttttatatatctatacgcatatcttcaatttcgatg |
200 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
19074345 |
ggtgtcacccttgaggattttaagctcattaagatgcatatgtccaattgtatgtatgctcactttttatatatctatatgcatatcttcaatttcgatg |
19074444 |
T |
 |
| Q |
201 |
tttggatagagggttttggagggtgaaatttatatatttgaattaagcgatttcannnnnnnnnnnnnnnnnnnnattagtgtagtaagtagtaatgctc |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
19074445 |
tttggatagagggttttggagggtgaaatttatatatttgaattaagcgatttcattttttattttactttttttattagtgtagtaagtagtaatgctc |
19074544 |
T |
 |
| Q |
301 |
gtgtaaaattgtgtactctctg |
322 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
19074545 |
gtgtaaaattgtgtactttctg |
19074566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University