View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4193_high_11 (Length: 483)
Name: NF4193_high_11
Description: NF4193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4193_high_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 233; Significance: 1e-128; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 233; E-Value: 1e-128
Query Start/End: Original strand, 9 - 309
Target Start/End: Complemental strand, 27693754 - 27693449
Alignment:
| Q |
9 |
gagatgaaggtaattatgagtagctgggatggaaagctgaaatgtaatagcagcaagtgtcgttatccagatgtatacagggagtatgtcaacggaattg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27693754 |
gagatgaaggtaattatgagtagctgggatggaaagctgaaatgtaatagcagcaagtgtggttatccagatgtatacagggagtatgtcaacggaattg |
27693655 |
T |
 |
| Q |
109 |
agcttcgttggcgaccaaaacgctgtgaacagcatcagcaagacagagaccgtgaccgggaagaggaacaattgtcataccgcagcatgatatacgatac |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
27693654 |
agcttcgttggcgaccaaaacgctgtgaacagcatcagcaagacagagaccgtgaccgggaagaggaacaattgtcataccccagcatgatatacgatac |
27693555 |
T |
 |
| Q |
209 |
agcagtgcgcgctctatttctcttcattctcttgcgtaagtnnnnnnnnnnncgcactagatacacatttagttaaaagaca-----cttctatcatatg |
303 |
Q |
| |
|
|||| || ||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
27693554 |
agcaatgggcgctctatttttcttcattctcttgcgtaagtaaaaaaaaaaacgcactagatacacatttagttaaaagacacttagcttctatcatatg |
27693455 |
T |
 |
| Q |
304 |
cattgg |
309 |
Q |
| |
|
|||||| |
|
|
| T |
27693454 |
cattgg |
27693449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 83; E-Value: 4e-39
Query Start/End: Original strand, 375 - 465
Target Start/End: Complemental strand, 27693383 - 27693293
Alignment:
| Q |
375 |
gaaatatatatgcattactctgtctcctgaaacaccattgaattacaacttacaagaaattcattaggatattcaacattctctgtggatg |
465 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27693383 |
gaaatatacatgcattactttgtctcctgaaacaccattgaattacaacttacaagaaattcattaggatattcaacattctctgtggatg |
27693293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University