View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4193_high_32 (Length: 304)
Name: NF4193_high_32
Description: NF4193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4193_high_32 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 207
Target Start/End: Original strand, 32410711 - 32410912
Alignment:
| Q |
1 |
agttggttacagaagtcacaggtggaaagggcgttacagttttcaagacaacaagttgcaaaattgtagtatttttaattaatccatccctctgcgtgaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
32410711 |
agttggttacagaagtcacaggtggaaagggcgttacagttttcaagacaacaagttgcaaaattgtagtatttttaattaatcc----ctctgcgtgaa |
32410806 |
T |
|
| Q |
101 |
actactctttcttcaactagacagatttgctccccaaaattggcaattgttcgccactcagaaaaagaaactgcaaactttagagctcaaacgatgcatt |
200 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32410807 |
actactctttcttcaa-tagacagatttgctccccaaaattggcaattgttcgccactcagaaaaagaaactgcaaactttagagctcaaacgatgcatt |
32410905 |
T |
|
| Q |
201 |
cctattg |
207 |
Q |
| |
|
||||||| |
|
|
| T |
32410906 |
cctattg |
32410912 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University