View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4193_high_35 (Length: 296)
Name: NF4193_high_35
Description: NF4193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4193_high_35 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 19 - 290
Target Start/End: Original strand, 26368907 - 26369178
Alignment:
| Q |
19 |
gcaaaagcatatctccagagaaagaatgctcatataaaatatttggaagaaaaacaaaactccctaacagtaattccatgatctttcaaccatagttgta |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26368907 |
gcaaaagcatatctccagagaaagaatgctcacataaaatatttggaagaaaaacaaaactccctaacagtaattccatgatctttcaaccatagttgta |
26369006 |
T |
|
| Q |
119 |
tattcctcataaattgatattttcctatgagctaactctttaactatgcagcaaataatttgtgaagaaaactcaacgacccaattatacaagggcattg |
218 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26369007 |
tattcctcacaaattgatattttcctatgagctaactctttaactatgcagcaaataatttgtgaagaaaactcaacgacccaattatacaagggcattg |
26369106 |
T |
|
| Q |
219 |
ggtcggtgcttaagacagaacggaatgtacttcaagaaactttgtcaaaagtcaattcaaatggggaggttc |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26369107 |
ggtcggtgcttaagacagaacggaatgtactacaagaaactttgtcaaaagtcaattcaaatggggaggttc |
26369178 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University