View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4193_high_37 (Length: 285)
Name: NF4193_high_37
Description: NF4193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4193_high_37 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 243; Significance: 1e-135; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 19 - 269
Target Start/End: Original strand, 49583756 - 49584006
Alignment:
| Q |
19 |
ggtttagtccttggtttatatatatttgggaagaacttcgttgaagtgaaaaaatttatcggcaataagaagatgaaggacatattgtcattctattatg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49583756 |
ggtttagtccttggtttatatatatttgggaagaacttcgttgaagtgaaaaaatttatcggcaataagaagatgaaggacatattgtcattctattatg |
49583855 |
T |
|
| Q |
119 |
gaaaatttcgtaagtcttacaaatatcagagatggtgtggatgtagggaaggcaaaagcaagaaatgcaacttagggcataaaattttcactgaatcaag |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49583856 |
gaaaatttcgtaagtcttacaaatatcagagatggtgtggatgtagggaagggaaaagcaagaaatgcaacttagggcataaaattttcactgaatcaag |
49583955 |
T |
|
| Q |
219 |
gcaacgtgagcttttgtttcgtctgatgccgaatgtaccggaggaagttca |
269 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
49583956 |
gcaacgtgagcttttgtttcgtctgataccgaatgtaccggaggaagttca |
49584006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 21 - 119
Target Start/End: Original strand, 49589055 - 49589153
Alignment:
| Q |
21 |
tttagtccttggtttatatatatttgggaagaacttcgttgaagtgaaaaaatttatcggcaataagaagatgaaggacatattgtcattctattatgg |
119 |
Q |
| |
|
|||||||||||| || |||| ||||||||||||||||||| ||||||||| ||||| |||||||||| |||||||| | | |||||||||||||||| |
|
|
| T |
49589055 |
tttagtccttggcttttatacatttgggaagaacttcgttcaagtgaaaaggtttatacgcaataagaaaatgaaggataaactgtcattctattatgg |
49589153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University