View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4193_high_47 (Length: 253)

Name: NF4193_high_47
Description: NF4193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4193_high_47
NF4193_high_47
[»] chr3 (1 HSPs)
chr3 (13-105)||(33511826-33511918)


Alignment Details
Target: chr3 (Bit Score: 89; Significance: 5e-43; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 13 - 105
Target Start/End: Complemental strand, 33511918 - 33511826
Alignment:
13 aatatgccaaaggatcattactgatggacaccataaatgaaatgcatggtacgatttcaagttctgaacaatagctaggttcttcccccttcc 105  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33511918 aatatgccaaaggatcattagtgatggacaccataaatgaaatgcatggtacgatttcaagttctgaacaatagctaggttcttcccccttcc 33511826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University