View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4193_high_47 (Length: 253)
Name: NF4193_high_47
Description: NF4193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4193_high_47 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 89; Significance: 5e-43; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 13 - 105
Target Start/End: Complemental strand, 33511918 - 33511826
Alignment:
| Q |
13 |
aatatgccaaaggatcattactgatggacaccataaatgaaatgcatggtacgatttcaagttctgaacaatagctaggttcttcccccttcc |
105 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33511918 |
aatatgccaaaggatcattagtgatggacaccataaatgaaatgcatggtacgatttcaagttctgaacaatagctaggttcttcccccttcc |
33511826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University