View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4193_high_61 (Length: 237)

Name: NF4193_high_61
Description: NF4193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4193_high_61
NF4193_high_61
[»] chr1 (1 HSPs)
chr1 (1-221)||(1598846-1599066)


Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 1599066 - 1598846
Alignment:
1 aaaaaataaatatttgcttataataatcatctcatggactaatttagaagatggggaatatgctttctcttttttatcatgcaattattatctcaaattc 100  Q
    |||||||||||||||| |||||||||| |||| || ||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||    
1599066 aaaaaataaatatttgtttataataataatctgatagactaatttagaagatggggaatatactttctcttttttatcatgcaattgttatctcaaattc 1598967  T
101 tctttcaatttgatccttccccgggaaaagaaattgctcattatggaaactttcacatgctatattgaggcaattaggaccaccatcatcttatggtgga 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1598966 tctttcaatttgatccttccccgggaaaagaaattgctcattatggaaactttcacatgctatattgaggcaattaggaccaccatcatcttatggtgga 1598867  T
201 tgctacgcacgtggctacatg 221  Q
    ||||||||||||| |||||||    
1598866 tgctacgcacgtgactacatg 1598846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University