View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4193_high_62 (Length: 237)

Name: NF4193_high_62
Description: NF4193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4193_high_62
NF4193_high_62
[»] chr7 (1 HSPs)
chr7 (149-222)||(45913524-45913597)


Alignment Details
Target: chr7 (Bit Score: 66; Significance: 3e-29; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 149 - 222
Target Start/End: Original strand, 45913524 - 45913597
Alignment:
149 aatgagtgtttttgtaaagttgagctaggacagtttgttttgtatcgaagaaaacagaaaccgcgggatatatg 222  Q
    ||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||    
45913524 aatgagtgtttttgtaaagttgagctaggacagtttgttatgtattgaagaaaacagaaaccgcgggatatatg 45913597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University