View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4193_high_8 (Length: 547)
Name: NF4193_high_8
Description: NF4193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4193_high_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 9 - 376
Target Start/End: Complemental strand, 40464470 - 40464099
Alignment:
| Q |
9 |
aactagcgagtctctaatcaaaccgcatgactatagacgaatttggatttatgaagttagaggattccgcatt----catgcagttgtaacaacattggt |
104 |
Q |
| |
|
||||||||||||| | |||||||||||||| ||||||||||||||||||| ||||||||||||| ||||||| ||||||||||| |||||||||| |
|
|
| T |
40464470 |
aactagcgagtctttgatcaaaccgcatgattatagacgaatttggatttgagaagttagaggatcccgcattaattcatgcagttgtgacaacattggc |
40464371 |
T |
 |
| Q |
105 |
agtcatttaatcaaaattagacaattcataaaatgtaaattttaatttagaccttctaatatttgattaaatgggcactgatattctaaccgcgtgaact |
204 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40464370 |
agtcgtttaatcaaaattagacaattcataaaatgtaaattttaatttagaccttctaatatttgattaaatgggcactgatattctaaccgcgtgaact |
40464271 |
T |
 |
| Q |
205 |
aggtgtatatctataaatgtaagggtgctgaatccactattaaacttgtgaatcatttcaaaacttagtgaatcactactatgatttagtatataagaga |
304 |
Q |
| |
|
||| |||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
40464270 |
aggggtatctctataaatgtaagggtgctgaatccactattaaacttgtgaatcattccaaaaattagtgaatcactactacgatgtagtatataagaga |
40464171 |
T |
 |
| Q |
305 |
tactaataaatattattggtcatatatgtgttggtaaattttgatggtctattatagactaaaaatataacc |
376 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40464170 |
tactagtaaatattattggtcatatatgttttggtaaattttgatggtctattatagactaaaaatataacc |
40464099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University