View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4193_low_26 (Length: 342)
Name: NF4193_low_26
Description: NF4193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4193_low_26 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 18 - 332
Target Start/End: Original strand, 5440069 - 5440383
Alignment:
| Q |
18 |
aaaactagcttagcagagcctatacaattaaggtcatgttgtttggctaatatgcataatttagagacattcaattaaacacaaaacttattttgctata |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
5440069 |
aaaactagcttagcagagcctatacaattaaggtcacgttgtttggctaatatgcataatttagagacatccaattaaacacaaaacttattttgctata |
5440168 |
T |
 |
| Q |
118 |
tttacatctctttaccggtcttccattttctatctgttcatgtatttcttggtgtagctnnnnnnncgtcttgggaaatttttcggttaaaaaggaaaat |
217 |
Q |
| |
|
||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
5440169 |
tttacatatctttaccggtcttcctttttctatctgttcatgtatttcttggtgtagctaaaaaaacgttttgggaaatttttcggttaaaaaggaaaat |
5440268 |
T |
 |
| Q |
218 |
atagtaaaatgagtgtgagccccgtgatttatttatttttgttgaaaagggtgcgtgatagccatggaggagaagaatttcattaaacattgattgtttc |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
5440269 |
atagtaaaatgagtgtgagccccgtgatttatttatttttgttgaaaagggtgcgtgatagccatggaggagaagaatttcattaaacattgactgtttc |
5440368 |
T |
 |
| Q |
318 |
ttttccaaccctatg |
332 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
5440369 |
ttttccaaccctatg |
5440383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University