View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4193_low_34 (Length: 304)

Name: NF4193_low_34
Description: NF4193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4193_low_34
NF4193_low_34
[»] chr4 (1 HSPs)
chr4 (1-207)||(32410711-32410912)


Alignment Details
Target: chr4 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 207
Target Start/End: Original strand, 32410711 - 32410912
Alignment:
1 agttggttacagaagtcacaggtggaaagggcgttacagttttcaagacaacaagttgcaaaattgtagtatttttaattaatccatccctctgcgtgaa 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    |||||||||||    
32410711 agttggttacagaagtcacaggtggaaagggcgttacagttttcaagacaacaagttgcaaaattgtagtatttttaattaatcc----ctctgcgtgaa 32410806  T
101 actactctttcttcaactagacagatttgctccccaaaattggcaattgttcgccactcagaaaaagaaactgcaaactttagagctcaaacgatgcatt 200  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32410807 actactctttcttcaa-tagacagatttgctccccaaaattggcaattgttcgccactcagaaaaagaaactgcaaactttagagctcaaacgatgcatt 32410905  T
201 cctattg 207  Q
    |||||||    
32410906 cctattg 32410912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University