View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4193_low_63 (Length: 242)
Name: NF4193_low_63
Description: NF4193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4193_low_63 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 161; Significance: 5e-86; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 17 - 181
Target Start/End: Original strand, 35454013 - 35454177
Alignment:
| Q |
17 |
actatgcacataacttatggaatttctattatgtgaatggcatatggaatttctgttatgtgattggggtcagggtgatgtgatttgaaactttgaataa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
35454013 |
actatgcacataacttatggaatttctattatgtgaatggcatatggaatttctgttatgtgattggggtcagggtgatgtggtttgaaactttgaataa |
35454112 |
T |
 |
| Q |
117 |
gcattaatccttcctaattgtagagtctggttagtgttggataaccattaatccttcaacagtaa |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35454113 |
gcattaatccttcctaattgtagagtctggttagtgttggataaccattaatccttcaacagtaa |
35454177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 203 - 242
Target Start/End: Original strand, 35454153 - 35454192
Alignment:
| Q |
203 |
ataaccattaatcctccaacagtaaatgtaatattaaact |
242 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35454153 |
ataaccattaatccttcaacagtaaatgtaatattaaact |
35454192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University