View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4193_low_65 (Length: 240)
Name: NF4193_low_65
Description: NF4193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4193_low_65 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 18 - 240
Target Start/End: Original strand, 29489689 - 29489911
Alignment:
| Q |
18 |
gttatccacacatatatatcattatctagagtgaagggccaaaatagctcatgaaatccaaaggatagatttacctcatcttcaaagagataagaagagt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29489689 |
gttatccacacatatatatcattatctagagtgaagggccaaaatagctcatgaaatccaaaggatagatttacctcatcttcaaagagataagaagagt |
29489788 |
T |
 |
| Q |
118 |
ggttttcagttccatataattatataatgtgtgagtgagatgtcannnnnnnnnnnnnnnnnnnnnctctttaaggctgaatttttgtattgatttagat |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
29489789 |
ggttttcagttccatataattatataatgtgtgagtgagatgtcattttctttttttcatttttttctctttaaggctgaatttttgtattgatttagat |
29489888 |
T |
 |
| Q |
218 |
aaaaatgtggacaagggtatagc |
240 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
29489889 |
aaaaatgtggacaagggtatagc |
29489911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University