View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4193_low_68 (Length: 237)
Name: NF4193_low_68
Description: NF4193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4193_low_68 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 66; Significance: 3e-29; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 149 - 222
Target Start/End: Original strand, 45913524 - 45913597
Alignment:
| Q |
149 |
aatgagtgtttttgtaaagttgagctaggacagtttgttttgtatcgaagaaaacagaaaccgcgggatatatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
45913524 |
aatgagtgtttttgtaaagttgagctaggacagtttgttatgtattgaagaaaacagaaaccgcgggatatatg |
45913597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University