View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4193_low_70 (Length: 224)
Name: NF4193_low_70
Description: NF4193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4193_low_70 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 16 - 206
Target Start/End: Complemental strand, 35879142 - 35878941
Alignment:
| Q |
16 |
acagactaaaaaagatttggaccaccctttgtttctaattatta---ttggattttt-cttttacaaaaggactaattattattggcttatttattgcat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
35879142 |
acagactaaaaaagatttggaccaccctttgtttctaattattactattggattttttcttttgcaaaaggactaattattattggcttatttattgcat |
35879043 |
T |
 |
| Q |
112 |
tgtgatacatacacggcaatt------taataaactagctaggaaaagaagaaacgaagat-actcctaaatgagtcgttgtggggaattacaggccata |
204 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35879042 |
tgtgatacatacacggcaatttactactaataaactaactaggaaaagaagaaacgaagataactcctaaatgagtcggtgtggggaattacaggccata |
35878943 |
T |
 |
| Q |
205 |
gg |
206 |
Q |
| |
|
|| |
|
|
| T |
35878942 |
gg |
35878941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University