View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4193_low_71 (Length: 222)
Name: NF4193_low_71
Description: NF4193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4193_low_71 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 22 - 209
Target Start/End: Original strand, 14452919 - 14453106
Alignment:
| Q |
22 |
ccaggatcatcatcaaatggcaccatgttaggtcctgtcgcccgaattagcaaacattggactgctcttactgcccttatacctctaaagaattaagcag |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
14452919 |
ccaggatcatcatcaaatggcaccatgttaggtcctgtcgcccgaattagcaaacattggactgctcttactgcccttgtacctctaaagaattaagcag |
14453018 |
T |
|
| Q |
122 |
tcatggccttcacagtcacagctatgatcataatgctaaaacacatgcatcaatgatttaagaataaagacacttatttatctctgct |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
14453019 |
tcatggccttcacagtcacagctatgatcataatgctaaaacacatgcatcaatgatttaagaataaagacacttatttatctttgct |
14453106 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University