View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4193_low_74 (Length: 211)

Name: NF4193_low_74
Description: NF4193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4193_low_74
NF4193_low_74
[»] chr2 (2 HSPs)
chr2 (100-192)||(10727532-10727624)
chr2 (15-58)||(10727660-10727703)


Alignment Details
Target: chr2 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 100 - 192
Target Start/End: Complemental strand, 10727624 - 10727532
Alignment:
100 catgtaatgtcgcagaattgggtgtgacattgttttggagcgaacgtggttcttaagctaaggaaaagctacaattataggccatcaatttct 192  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10727624 catgtaatgtcgcagaattgggtgtgacattgttttggagcgaacgtggttcttaagctaaggaaaagctacaattataggccatcaatttct 10727532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 15 - 58
Target Start/End: Complemental strand, 10727703 - 10727660
Alignment:
15 atgaatgaatgagtacttttttgcaatatcgtttgttgtctgtt 58  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
10727703 atgaatgaatgagtacttttttgcaatatcgtttgttgtctgtt 10727660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University