View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4193_low_74 (Length: 211)
Name: NF4193_low_74
Description: NF4193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4193_low_74 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 100 - 192
Target Start/End: Complemental strand, 10727624 - 10727532
Alignment:
| Q |
100 |
catgtaatgtcgcagaattgggtgtgacattgttttggagcgaacgtggttcttaagctaaggaaaagctacaattataggccatcaatttct |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10727624 |
catgtaatgtcgcagaattgggtgtgacattgttttggagcgaacgtggttcttaagctaaggaaaagctacaattataggccatcaatttct |
10727532 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 15 - 58
Target Start/End: Complemental strand, 10727703 - 10727660
Alignment:
| Q |
15 |
atgaatgaatgagtacttttttgcaatatcgtttgttgtctgtt |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10727703 |
atgaatgaatgagtacttttttgcaatatcgtttgttgtctgtt |
10727660 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University