View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4193_low_75 (Length: 205)
Name: NF4193_low_75
Description: NF4193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4193_low_75 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 139; Significance: 6e-73; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 12 - 186
Target Start/End: Original strand, 15406465 - 15406639
Alignment:
| Q |
12 |
agattattctcctttctctgtctcacaacctgaaccttccttttctaccttcactgcttctccctctgtcttcatactctttgcatgcttctttgccttc |
111 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
15406465 |
agattcttctcctttctttgtctcacaacctgaaccttccttttctaccttcactgcttctccctctgtcttcatactctttgcatgcttctttgctttc |
15406564 |
T |
 |
| Q |
112 |
aataccttcataacctctaaaatcacaaatataacacnnnnnnnnttaacaacatgaagcaacaaaatagccaat |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
15406565 |
aataccttcataacctctaaaatcacaaatataacacaaaaaaaattaacaacatgaagcaacaaaatagccaat |
15406639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University