View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4194_high_6 (Length: 251)
Name: NF4194_high_6
Description: NF4194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4194_high_6 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 40 - 251
Target Start/End: Complemental strand, 7660966 - 7660755
Alignment:
| Q |
40 |
aatatggtatcataatattctcaaagatttcatgaaccgcgacaatattaaatacattttcaaaccatatttctattttaaatggaacttgtgattttct |
139 |
Q |
| |
|
|||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7660966 |
aatatgatatcataatattctcaaagattccatgaaccgcgacaatattaaatacattttcaaaccatatttctattttaaatggaacttgtgattttct |
7660867 |
T |
|
| Q |
140 |
cggtattatttattatctttcgtggtgaattactcaaaccataaattatttgtaatttgatcagttttttactcattgtatttgcaaaataatttgcgat |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7660866 |
cggtattatttattatctttcgtggtgaattactcaaaccataaattatttgtattttgatcagttttttactcattgtatttgcaaaataatttgcgat |
7660767 |
T |
|
| Q |
240 |
gtctgctcatct |
251 |
Q |
| |
|
|||||||||||| |
|
|
| T |
7660766 |
gtctgctcatct |
7660755 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University