View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4194_high_7 (Length: 250)
Name: NF4194_high_7
Description: NF4194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4194_high_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 25494950 - 25495192
Alignment:
| Q |
1 |
cccaaaccatgtttctgaatgttaaacttaccagttaggatttcagattcttgatgatcttcatcaccaccaatacctatccatgcaggccaaccagcaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25494950 |
cccaaaccatgtttctgaatgttaaacttcccagttaggatttcagattcttgatgatcttcatcaccaccaatacctatccatgcaggccaaccagcaa |
25495049 |
T |
 |
| Q |
101 |
cgattgcccaaatagaggattcaacacattcaggcttctctacaaatgaaatattgagtgtagttcctgtaaagattataccagggcttattcctggtat |
200 |
Q |
| |
|
| || ||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25495050 |
ctatagcccaaatagaggattcaacacactgaggcttctctacaaatgaaatattgagtgtagttcctgtaaagattataccagggcttattcctggtat |
25495149 |
T |
 |
| Q |
201 |
gataaatttcacttgtaggccattcacaacctcagaataatct |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25495150 |
gataaatttcacttgtaggccattcacaacctcagaataatct |
25495192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 175 - 224
Target Start/End: Complemental strand, 20493574 - 20493525
Alignment:
| Q |
175 |
attataccagggcttattcctggtatgataaatttcacttgtaggccatt |
224 |
Q |
| |
|
||||||||||| ||||||||||||||| | ||||||||| |||| ||||| |
|
|
| T |
20493574 |
attataccaggacttattcctggtatggtgaatttcactggtagaccatt |
20493525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University