View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4194_low_11 (Length: 229)
Name: NF4194_low_11
Description: NF4194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4194_low_11 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 27 - 229
Target Start/End: Complemental strand, 33760709 - 33760507
Alignment:
| Q |
27 |
caattttggtgacatcagggatactttaccaccaagtcacaataaatcgatgaataaaacaatctggtagttatacaaaatttaaaatagctcataatac |
126 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33760709 |
caattttggtgacatcggggatactttaccaccaagtcacaataaatcgatgaataaaacaatctggtagttatacaaaatttaaaatagctcataatac |
33760610 |
T |
|
| Q |
127 |
ttgtacagattgttaacaatagagatgatataataggagaaagagaaagatgttaggatttcaataacataaattttgcaaaagactaatattattcgat |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
33760609 |
ttgtacagattgttaacaatagagatgatataataggagaaagagaaagatgttaggatttcaataacataaattttgcaaaagactaatattactcgat |
33760510 |
T |
|
| Q |
227 |
gtt |
229 |
Q |
| |
|
||| |
|
|
| T |
33760509 |
gtt |
33760507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University