View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4194_low_12 (Length: 221)
Name: NF4194_low_12
Description: NF4194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4194_low_12 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-122; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 45648150 - 45647930
Alignment:
| Q |
1 |
ttgatacgtaagaagatcctatggttcttgcagatatcggattccagggaaccaagccaccagcagcatcttttctctgcccagaggtcttccaaagtgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45648150 |
ttgatacgtaagaagatcctatggttcttgcagatatcggattccagggaaccaagccaccagcagcatcttttctctgcccagaggtcttccaaagtgg |
45648051 |
T |
|
| Q |
101 |
tttctggagacctatgaaagcagaacatgaagctggctttaggcatctttcttctgtgcctgttaccaatggacatcttcaatcaagatctccgtttcct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45648050 |
tttctggagacctatgaaagcagaacatgaagctggctttaggcatctttcttctgtgcctgttaccaatggacatcttcaatcaagatctccgtttcct |
45647951 |
T |
|
| Q |
201 |
tcttacaacgaaaaacaattt |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
45647950 |
tcttacaacgaaaaacaattt |
45647930 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 110 - 154
Target Start/End: Complemental strand, 45641580 - 45641536
Alignment:
| Q |
110 |
acctatgaaagcagaacatgaagctggctttaggcatctttcttc |
154 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
45641580 |
acctatgaaagcagaacataaagctggctttaggcatctatcttc |
45641536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University