View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4194_low_8 (Length: 248)
Name: NF4194_low_8
Description: NF4194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4194_low_8 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 248
Target Start/End: Complemental strand, 45647991 - 45647744
Alignment:
| Q |
1 |
ctgttaccaatggacagcttcaatcaagatctccgtttccgtcttacaacgaaaaacaatttccattgcttcatgaaaatgttgccacatccactacagg |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
45647991 |
ctgttaccaatggacatcttcaatcaagatctccgtttccttcttacaacgaaaaacaatttccatttcttcatgaaaatgttgccacatccactacagg |
45647892 |
T |
 |
| Q |
101 |
cagtaagttcagtgaaaacaatagccattatgtgcatgccattggctacgcctcattaggaagtgaagacttcaatgtttttcacaccgcaccaagcatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
45647891 |
cagtaagttcagtgaaaacaatagccattacgcgcatgccattggctacgcctcattaggaaatgaagacttcaatgtttttcataccgcaccaagcatt |
45647792 |
T |
 |
| Q |
201 |
caaggattatcaggaatttcagactcttgtgctctctctcttctgtca |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45647791 |
caaggattatcaggaatttcagactcttgtgctctctctcttctgtca |
45647744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 157 - 240
Target Start/End: Complemental strand, 45641369 - 45641286
Alignment:
| Q |
157 |
taggaagtgaagacttcaatgtttttcacaccgcaccaagcattcaaggattatcaggaatttcagactcttgtgctctctctc |
240 |
Q |
| |
|
||||||||| | ||||||||| |||||| || || ||| | || |||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
45641369 |
taggaagtgcatacttcaatgcttttcatacatcatcaaccgtttaaggattatcaggaatttcagactcttgcgccctctctc |
45641286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University