View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4195_high_16 (Length: 201)
Name: NF4195_high_16
Description: NF4195
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4195_high_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 20 - 182
Target Start/End: Original strand, 13052396 - 13052558
Alignment:
| Q |
20 |
gaccgcatgaaatcccatgcggtccttcctaatgaaataaaatgatccttacctttgtgacgattccaccaaggtagactttgtacatgatcgactagat |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||| |||| || |||| ||||| |
|
|
| T |
13052396 |
gaccgcatgaaatcccatgcggtccttcctagtgaaataaaatgatccttaccattgtgacgattccaccaaggtagacttagtacgtggtcgattagat |
13052495 |
T |
 |
| Q |
120 |
caacagctagggagtcgcgaagagtatgattcgcctcgcggaacatgcttgaagcgtgtagtc |
182 |
Q |
| |
|
|||| |||| ||||||||| ||||| |||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
13052496 |
caacggctaaggagtcgcggagagtgtgattcgcttcgcggaacatgcttgacgcgtgtagtc |
13052558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University