View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4195_low_10 (Length: 348)
Name: NF4195_low_10
Description: NF4195
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4195_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 19 - 331
Target Start/End: Original strand, 7885949 - 7886261
Alignment:
| Q |
19 |
gggagattgaccagcaattcaataacaaaagttagcaccgtaacattagatatttctctacttgatctttcttttcgttttatagatagatcttagtcct |
118 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7885949 |
gggagattgaccagcagttcaataacaaaagttagcaccgtaacattagatatttctctacttgatctttcttttcgttttatagatagatcttagtcct |
7886048 |
T |
 |
| Q |
119 |
tacctggcgcatgcaccaaccaaacacccttgaggtctacttttttgcgtgtttattaaatttcgacttcaacgttggaattgcattaattgtaattttg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7886049 |
tacctggcgcatgcaccaaccaaacacccttgaggtctacttttttgcgtgtttattaaatttcgacttcaacgttggaattgcattaattgtaattttg |
7886148 |
T |
 |
| Q |
219 |
tctacaccaaaatcatataatcttacctgttggaagtatttgccaagacgttacagcgcaaacttcctgctgaatctccaacatgggtaaggaacttttg |
318 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7886149 |
tttacaccaaaatcatataatcttacctgttggaagtatttgctaagacgttacagcgcaaacttcctgctgaatctccaacatgggtaaggaacttttg |
7886248 |
T |
 |
| Q |
319 |
gatgtcaatgttc |
331 |
Q |
| |
|
||||||||||||| |
|
|
| T |
7886249 |
gatgtcaatgttc |
7886261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University