View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4195_low_12 (Length: 290)
Name: NF4195_low_12
Description: NF4195
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4195_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 9 - 275
Target Start/End: Original strand, 12274253 - 12274519
Alignment:
| Q |
9 |
accagagagactcattttcttcgatattgtcagcaaaatgccgaggaaggaacctgggccattgttgattttcctgttgatagcttccaacaaaactttc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12274253 |
accagagagactcattttcttcgatattgtcagcaaaatgccgaggaaggaacctgggccattgttgattttcctgttgatagcttccaacaaaactttc |
12274352 |
T |
 |
| Q |
109 |
acaattcttgtcccaaatactgcagaaggtcctctggctgtgtgattcaagacatgccaaatggctattcgagggtacacaatcagtcctagctattttt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12274353 |
acaattcttgtcccaaatactgcagaaggtcctctggctgtgtgattcaagacatgccaaatggctattcgagggtacacaatcagtcctagctattttt |
12274452 |
T |
 |
| Q |
209 |
attacattgttatgtatttgaattattcttcaaaacattaggatgtaaaataatagattgttgcttt |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12274453 |
attacattgttatgtatttgaattattcttcaaaacattaggatgtaaaataatagattgttgcttt |
12274519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University