View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4195_low_16 (Length: 236)
Name: NF4195_low_16
Description: NF4195
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4195_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 13052343 - 13052117
Alignment:
| Q |
1 |
aaaaatatgtcggtgctaacagttgaaagacaaccttgggaaggtgaaaaccaaaatggcataccttacccgtcgtattttcatccaaaaacaaaagaag |
100 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13052343 |
aaaaacatgtcggtgctaacaattgaaagacaaccttgggaaggtgaaaaccaaaacggcataccttacccgtcgtattttcatccaaaaacaaaagaag |
13052244 |
T |
|
| Q |
101 |
aaatgcttacgtggcagaataaaatgagacaaaacgacaggccgtttttgttttcatttattggtgggaaaagaaaagggttaggaaaagcaaagattcg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13052243 |
aaatgcttacgtggcagaataaaatgagacaaaacgacaggccgtttttgttttcatttattggtgggaaaagaaaagggttaggaaaagcaaagattcg |
13052144 |
T |
|
| Q |
201 |
tgatgagttggttaaacaatgtgatga |
227 |
Q |
| |
|
|||||||||| ||||||||||| |||| |
|
|
| T |
13052143 |
tgatgagttgtttaaacaatgtaatga |
13052117 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University