View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4196_high_2 (Length: 395)
Name: NF4196_high_2
Description: NF4196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4196_high_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 368; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 368; E-Value: 0
Query Start/End: Original strand, 18 - 385
Target Start/End: Original strand, 4256701 - 4257068
Alignment:
| Q |
18 |
gaattaagcaaatcaaaatacatcaaggtgaaacattatgccaaatagaaaatttgttaggagcattgcgatgcagaatgtcaaattacaaacataatgg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4256701 |
gaattaagcaaatcaaaatacatcaaggtgaaacattatgccaaatagaaaatttgttaggagcattgcgatgcagaatgtcaaattacaaacataatgg |
4256800 |
T |
|
| Q |
118 |
catatgctttttcaaagaagtttgaagtgttgagatcataacttaaagagttatgatgtctttttgatggttgtgtgtttcttaatttggctctgaaaaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4256801 |
catatgctttttcaaagaagtttgaagtgttgagatcataacttaaagagttatgatgtctttttgatggttgtgtgtttcttaatttggctctgaaaaa |
4256900 |
T |
|
| Q |
218 |
tgaataaaattacactatttgttctcctctgacctcacttttgctttaaaaatcggttgctctatttatttttcgaataggtataaacacgatggacaag |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4256901 |
tgaataaaattacactatttgttctcctctgacctcacttttgctttaaaaatcggttgctctatttatttttcgaataggtataaacacgatggacaag |
4257000 |
T |
|
| Q |
318 |
acgtcactcattaattttgcaaggtcttacttgaagaataagaggtatgtggtttactttgatgatgt |
385 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4257001 |
acgtcactcattaattttgcaaggtcttacttgaagaataagaggtatgtggtttactttgatgatgt |
4257068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University