View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4196_high_3 (Length: 393)
Name: NF4196_high_3
Description: NF4196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4196_high_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 119 - 376
Target Start/End: Original strand, 16610454 - 16610706
Alignment:
| Q |
119 |
acaatgaaggaagttgatgagtttgacattgtaattaattagggtaatggattgattaaaactagggttgatttaaggttatggttttgaatatgatttt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16610454 |
acaatgaaggaagttgatgagtttgacattgtaattaattagggtaatggattgattaaaactagggttgatttaaggttatggttttgaatatgatttt |
16610553 |
T |
 |
| Q |
219 |
gttggaatgagagggatttatagatgaagaaattaagtggaggaaacgtaaatgccatgggtttagaacgtgacttgtaggatggaactgtggaattatt |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16610554 |
gttggaatgagagggatttatagatgaagaaattaagttgaggaaacgtaa-----atgggtttagaacgtgacttgtaggatggaactgtggaattatt |
16610648 |
T |
 |
| Q |
319 |
tttaaggaataagagcacgtatatgaagcatggctgtcggtttattcatgcagaaaat |
376 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
16610649 |
tttaaggaataagagcacgtatatgaagcatgactgtcggtttatgcatgcagaaaat |
16610706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University