View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4196_low_11 (Length: 215)

Name: NF4196_low_11
Description: NF4196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4196_low_11
NF4196_low_11
[»] chr8 (2 HSPs)
chr8 (118-199)||(457196-457277)
chr8 (15-59)||(457336-457380)


Alignment Details
Target: chr8 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 118 - 199
Target Start/End: Complemental strand, 457277 - 457196
Alignment:
118 aactttcgcattaacataaacgtttgagatactagtatagagaagttgtgaaaatggcttatggcatggtcataagctattt 199  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
457277 aactttcgcattaacataaacgtttgagatactagtatagagacgttgtgaaaatggcttatggcatggtcataagctattt 457196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 15 - 59
Target Start/End: Complemental strand, 457380 - 457336
Alignment:
15 atagggtaaggttatatcaaatcaaattgtgtttctttcttaaca 59  Q
    |||||||||||||||||||||||||||||||||||||| ||||||    
457380 atagggtaaggttatatcaaatcaaattgtgtttcttttttaaca 457336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University