View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4196_low_11 (Length: 215)
Name: NF4196_low_11
Description: NF4196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4196_low_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 118 - 199
Target Start/End: Complemental strand, 457277 - 457196
Alignment:
| Q |
118 |
aactttcgcattaacataaacgtttgagatactagtatagagaagttgtgaaaatggcttatggcatggtcataagctattt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
457277 |
aactttcgcattaacataaacgtttgagatactagtatagagacgttgtgaaaatggcttatggcatggtcataagctattt |
457196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 15 - 59
Target Start/End: Complemental strand, 457380 - 457336
Alignment:
| Q |
15 |
atagggtaaggttatatcaaatcaaattgtgtttctttcttaaca |
59 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
457380 |
atagggtaaggttatatcaaatcaaattgtgtttcttttttaaca |
457336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University