View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4197_high_10 (Length: 356)
Name: NF4197_high_10
Description: NF4197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4197_high_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 89 - 345
Target Start/End: Complemental strand, 16641848 - 16641594
Alignment:
| Q |
89 |
ttacaacccaaagtgataaactattaaaatctcctatatgagttgttcttgtaaccccacaaaat-aattttgtaggtgaggattccacccaatactatt |
187 |
Q |
| |
|
|||||||||||||||| ||||||||| ||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| |||||| |
|
|
| T |
16641848 |
ttacaacccaaagtga---actattaaactctactatatgagttgttcttgtaaccccacaaaatcaattttgtaggtgaggattccagccaacactatt |
16641752 |
T |
 |
| Q |
188 |
gaactttggtgcatagatataattgatatatggtccgataacataagactgatagcaaataaatcaattgatatcgaaggaggttttaatatcatattaa |
287 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16641751 |
gaactttggtgcatagatataattgatgtatggtccgataacataagactgatagcaaataaatcaattgatatcgaaggaggttttaatatcatattaa |
16641652 |
T |
 |
| Q |
288 |
aatttgtgattggtcataacaaaacatacaaaattaacttgtgaggtacggtttacat |
345 |
Q |
| |
|
|||| ||||||||||||||||||||||| |||||||| |||||||||| ||||||||| |
|
|
| T |
16641651 |
aattcgtgattggtcataacaaaacatataaaattaatttgtgaggtagggtttacat |
16641594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University