View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4197_high_29 (Length: 224)
Name: NF4197_high_29
Description: NF4197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4197_high_29 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 17 - 208
Target Start/End: Complemental strand, 27145093 - 27144902
Alignment:
| Q |
17 |
gaaaacgggtggcccaaatggttctatccggttcaggtacnnnnnnnnnnngtaattaacattcaaatccaatgatgttaacatatgtataagtataacc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27145093 |
gaaaacgggtggcccaaatggttctatccggttcaggtactttttttttttgtaattaacattcaaatccaatgatgttaacatatgtataagtataacc |
27144994 |
T |
|
| Q |
117 |
atagatgtagtctttgattctttttagaaacagttagtctgctaaataaggtactctaagattgttattgcattcaaagttgtctttcttat |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
27144993 |
atagatgtagtctttaattctttttagaaacagttagtcttctaaataaggtactctaagattgttattgcattgaaagttgtcttttttat |
27144902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University