View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4197_low_12 (Length: 356)

Name: NF4197_low_12
Description: NF4197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4197_low_12
NF4197_low_12
[»] chr2 (1 HSPs)
chr2 (89-345)||(16641594-16641848)


Alignment Details
Target: chr2 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 89 - 345
Target Start/End: Complemental strand, 16641848 - 16641594
Alignment:
89 ttacaacccaaagtgataaactattaaaatctcctatatgagttgttcttgtaaccccacaaaat-aattttgtaggtgaggattccacccaatactatt 187  Q
    ||||||||||||||||   ||||||||| ||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| ||||||    
16641848 ttacaacccaaagtga---actattaaactctactatatgagttgttcttgtaaccccacaaaatcaattttgtaggtgaggattccagccaacactatt 16641752  T
188 gaactttggtgcatagatataattgatatatggtccgataacataagactgatagcaaataaatcaattgatatcgaaggaggttttaatatcatattaa 287  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
16641751 gaactttggtgcatagatataattgatgtatggtccgataacataagactgatagcaaataaatcaattgatatcgaaggaggttttaatatcatattaa 16641652  T
288 aatttgtgattggtcataacaaaacatacaaaattaacttgtgaggtacggtttacat 345  Q
    |||| ||||||||||||||||||||||| |||||||| |||||||||| |||||||||    
16641651 aattcgtgattggtcataacaaaacatataaaattaatttgtgaggtagggtttacat 16641594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University