View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4197_low_19 (Length: 279)
Name: NF4197_low_19
Description: NF4197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4197_low_19 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 1 - 276
Target Start/End: Original strand, 33162601 - 33162876
Alignment:
| Q |
1 |
aacaacgtcgttaaacttaaacggtccttttaatagcttcatagcttcaagaggggttgttcctttatacatgagtatttcacaacggtttccnnnnnnn |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
33162601 |
aacaacgtcgttaaacttaaacggtccttttaatagcttcatagcttcaagaggggttcttcctttatatatgagtatttcacaacggtttccgtttttt |
33162700 |
T |
|
| Q |
101 |
gataacactttggatatagttcattccatgcatgttttgagtaattggataccagaaacattgcttcattttttgttgtttgatgtttatagggttctta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33162701 |
gataacactttggatatagttcattccatgcatgttttgagtaattggataccagaaacattgcttcattttttgttgtttgatgtttatagggttctta |
33162800 |
T |
|
| Q |
201 |
gacctggtgggttgttttggttggaccatttcttttgtgttggggatcaattggagaatgtttatggacctatgat |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33162801 |
gacctggtgggttgttttggttggaccatttcttttgtgttggggatcaattggagaatgtttatggacctatgat |
33162876 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University