View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4197_low_21 (Length: 270)

Name: NF4197_low_21
Description: NF4197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4197_low_21
NF4197_low_21
[»] chr8 (2 HSPs)
chr8 (12-254)||(39369289-39369531)
chr8 (12-245)||(39355106-39355339)


Alignment Details
Target: chr8 (Bit Score: 239; Significance: 1e-132; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 12 - 254
Target Start/End: Original strand, 39369289 - 39369531
Alignment:
12 gaagaaaatatgtgatcatccacttcttctgacaaagcgtgcagctgaggatgtgttgaacgggatggactcaatgctcaagccaaacgaggttaatgtt 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39369289 gaagaaaatatgtgatcatccacttcttctgacaaagcgtgcagctgaggatgtgttgaacgggatggactcaatgctcaagccaaacgaggttaatgtt 39369388  T
112 gcagagatattggtgaagcatataacggatgttgtaaaaacatatacgtttaaagatgagaacgatgtaccatgcaaaatatcttttatcatgtcattat 211  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39369389 gcagagatattggtgaagcatataacggatgttgttaaaacatatacgtttaaagatgagaacgatgtaccatgcaaaatatcttttatcatgtcattat 39369488  T
212 tggtaagcgctgatgtcatgtaggtgcaatatatgctgttagt 254  Q
    |||||||||||||||||||||||||||||||||||||||||||    
39369489 tggtaagcgctgatgtcatgtaggtgcaatatatgctgttagt 39369531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 12 - 245
Target Start/End: Original strand, 39355106 - 39355339
Alignment:
12 gaagaaaatatgtgatcatccacttcttctgacaaagcgtgcagctgaggatgtgttgaacgggatggactcaatgctcaagccaaacgaggttaatgtt 111  Q
    ||||||||||||||||||||| |||||  |||| ||||| || || |||||||| ||| | ||| |||| |||||||| |||||| | ||||||||||||    
39355106 gaagaaaatatgtgatcatccgcttctgttgactaagcgggctgcggaggatgtattggatgggttggaatcaatgctaaagccagaggaggttaatgtt 39355205  T
112 gcagagatattggtgaagcatataacggatgttgtaaaaacatatacgtttaaagatgagaacgatgtaccatgcaaaatatcttttatcatgtcattat 211  Q
    || || | ||| | || ||||||| | ||||||| | ||||| ||| |||| ||||  || | |||||| |||||||||||  ||| |||||||||||||    
39355206 gcggaaaaattagcgatgcatatagcagatgttgcagaaacagataagtttgaagacaagcatgatgtatcatgcaaaatagttttcatcatgtcattat 39355305  T
212 tggtaagcgctgatgtcatgtaggtgcaatatat 245  Q
    ||||||| || ||||||||||   ||||||||||    
39355306 tggtaagtgccgatgtcatgtgcatgcaatatat 39355339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University