View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4197_low_23 (Length: 264)
Name: NF4197_low_23
Description: NF4197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4197_low_23 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 15 - 264
Target Start/End: Original strand, 2755406 - 2755655
Alignment:
| Q |
15 |
taggtcaattgcgccaaagggatcatcattatttgaaagagtaggagattgaggagaaggagaacgagaacgattggacaaagagttaacggtacaagat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
2755406 |
taggtcaattgcgccaaagggatcatcattatttgaaagagtaggagattgaggagaaggagaacgagaacgattggacaaagagttaacgggacaagat |
2755505 |
T |
 |
| Q |
115 |
agatctttaacatcaataggtgggacgtcttgtatttgcttcggtggtggtggtcgaagctcgacaagatcaatgtcccatagaacccaatttgtcgttt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2755506 |
agatctttaacatcaataggtgggacgtcttgtatttgcttcggtggtggtggtcgaagctcgacaagatcaatgtcccatagaacccaatttgtcgttt |
2755605 |
T |
 |
| Q |
215 |
ttgtacgatatggaatatcatgggtgacggagtttctccatggtggtaac |
264 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
2755606 |
ttgtacgatatggaatatcatgcgtgacggagtttctccatggtggtaac |
2755655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University