View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4197_low_29 (Length: 240)
Name: NF4197_low_29
Description: NF4197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4197_low_29 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 33162580 - 33162355
Alignment:
| Q |
1 |
tttcattcgaaccgcgaaagttgctactcccccacctatgtctaaaccgattcgaatcgaaccgggtttacgtgtttctaaaacatcatcgatactgaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
33162580 |
tttcattcgaaccgcgaaagttgctactccaccacctatgtctaaaccgattcgaaccgaaccgggtttacgtgtttctaaaacatcgtcgatactgaaa |
33162481 |
T |
 |
| Q |
101 |
tctagacctttcgatctagggtttgtccaacggtgcttctcccggccgttgagatcaaaacagtctttacaatcatcaaagcctctctgattgcgggaac |
200 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
33162480 |
tctagaccgtttgatctagggtttgtccaacggtgcttctcacggccgttgagatcaaaacagtctttacaatcatcaaagcctctctgcgtgcgggaac |
33162381 |
T |
 |
| Q |
201 |
ggtcaatgagacatgtgtaggatttg |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
33162380 |
ggtcaatgagacatgtgtaggatttg |
33162355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University