View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4198_high_3 (Length: 216)

Name: NF4198_high_3
Description: NF4198
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4198_high_3
NF4198_high_3
[»] chr1 (2 HSPs)
chr1 (17-189)||(38538175-38538347)
chr1 (17-189)||(38560393-38560565)


Alignment Details
Target: chr1 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 17 - 189
Target Start/End: Original strand, 38538175 - 38538347
Alignment:
17 tgaaactagagatcagagatatatatgaacaacttagttggacataatatgatggacatggactgatcactgatgcagtgcagaatgtgacggtgaattt 116  Q
    ||||||||||||||||||||||  |  |   |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38538175 tgaaactagagatcagagatatgaacaacttacttagttggacataatatgatggacatggactgatcactgatgcagtgcagaatgtgacggtgaattt 38538274  T
117 attagtacaaagttagttgaacccgtgagccatatgcctcataaataattataataacattagactttgtaca 189  Q
    || |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
38538275 atcagtacaaagttagttgaacccgtgagccatatgcctcataaataatgataataacattagactttgtaca 38538347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 17 - 189
Target Start/End: Original strand, 38560393 - 38560565
Alignment:
17 tgaaactagagatcagagatatatatgaacaacttagttggacataatatgatggacatggactgatcactgatgcagtgcagaatgtgacggtgaattt 116  Q
    ||||||||||||||||||||||  |  |   |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38560393 tgaaactagagatcagagatatgaacaacttacttagttggacataatatgatggacatggactgatcactgatgcagtgcagaatgtgacggtgaattt 38560492  T
117 attagtacaaagttagttgaacccgtgagccatatgcctcataaataattataataacattagactttgtaca 189  Q
    || |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
38560493 atcagtacaaagttagttgaacccgtgagccatatgcctcataaataatgataataacattagactttgtaca 38560565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University