View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4200_low_2 (Length: 520)
Name: NF4200_low_2
Description: NF4200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4200_low_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 376; Significance: 0; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 376; E-Value: 0
Query Start/End: Original strand, 20 - 419
Target Start/End: Complemental strand, 37225750 - 37225351
Alignment:
| Q |
20 |
gagtggggtttcttcatactaaccaatcactctgtatcaaagagtctcatggagaaaatggttgaccaagtttttgctttctttaatcttaaagaagaag |
119 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
37225750 |
gagtggggattcttcatactaaccaatcactctgtatcaaagagtctcatggagaaaatggttgaccaagtttttgctttctttaaccttaaagaagaag |
37225651 |
T |
 |
| Q |
120 |
ataaacaagtgtatgcagataaggaagtaaaggatgattcaataaagtatggtacaagcttcaatgtttcaggggataaaaacttgttctggagggattt |
219 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37225650 |
ataagcaagtgtatgcagataaggaagtaacggatgattcaataaagtatggtacaagcttcaatgtttcaggggataaaaacttgttctggagggattt |
37225551 |
T |
 |
| Q |
220 |
cattaaaattattgttcatcctgaatttcactcaccggataaaccttctggcttcaggtttttgcttattctctcttttgctttttccttgcaactctaa |
319 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
37225550 |
cattaaaattattgttcatcctaaatttcactcaccggataaaccttctggcttcaggtttttgcttattctctcttttactttttccttgcaactctaa |
37225451 |
T |
 |
| Q |
320 |
atccaccatatgctcagtctaaatcaccacatgttgtagattcttaggttgctttgctcataagttttaagttctaaattgtttgtggttatagacttat |
419 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37225450 |
atccaccatatgctcagtctaaatcaccacatgttgtagattcttaggttgctttgctcataagttttaagttctaaattgtttgtggttatagacttat |
37225351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 90; E-Value: 3e-43
Query Start/End: Original strand, 417 - 506
Target Start/End: Complemental strand, 37224817 - 37224728
Alignment:
| Q |
417 |
tatgttaacttaagtactactccatccgtctcattataagtatctgatttgagttgtgcacggttctttaagaatatgattagttgtgtt |
506 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37224817 |
tatgttaacttaagtactactccatccgtctcattataagtatctgatttgagttgtgcacggttctttaagaatatgattagttgtgtt |
37224728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University