View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4201-Insertion-16 (Length: 351)
Name: NF4201-Insertion-16
Description: NF4201
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4201-Insertion-16 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 191; Significance: 1e-103; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 191; E-Value: 1e-103
Query Start/End: Original strand, 113 - 351
Target Start/End: Complemental strand, 3347863 - 3347624
Alignment:
| Q |
113 |
atagggataaggatgcttaattactcttgagtgcacacaataaaataattgnnnnnnn-ctaacatccctttcatttcaattaaagataaaccacccgat |
211 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
3347863 |
atagggatacggatgcttaattactcttgagtgcacacaataaaataattgttttttttctaacatccctttcatttcaattaaagaaaaaccacccgat |
3347764 |
T |
|
| Q |
212 |
tagtgggatgaagggttggtccagacgcagaacaaaagcttaccaattggaaaacacgatcatctaatttgtcccttattatttacttcccttcctccgt |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
3347763 |
tagtgggatgaagggttggtccagacgcagaacaaaagcttaccagttggaaaacacgatcatctaatttgtcgcttattatttacttcctttcctccgt |
3347664 |
T |
|
| Q |
312 |
ctttaaatatatgattgatttaagagtaaggtcattaaaa |
351 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3347663 |
ctttaaatatatgattgatttaagagtaaggtcattaaaa |
3347624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 7 - 73
Target Start/End: Complemental strand, 3347967 - 3347903
Alignment:
| Q |
7 |
agaaattgcagtataccaccgaaagagagagtgtggaggcagatacagattcttgaggcatgaggtc |
73 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
3347967 |
agaaattgcagtataccaccgaaagagag--tgtggaggcagatacagattcttgaggcatgaggtc |
3347903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University