View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4201-Insertion-17 (Length: 281)
Name: NF4201-Insertion-17
Description: NF4201
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4201-Insertion-17 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 54; Significance: 5e-22; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 212 - 281
Target Start/End: Original strand, 29235392 - 29235461
Alignment:
| Q |
212 |
gaatactcttctcttccttgaagatattgaaacaatttacaaatttaatttgctctacatatgagggaaa |
281 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||| || | |||||||||||||||||||| |
|
|
| T |
29235392 |
gaatactcttctcttccttgaggatattgaaacaatttacaaatctactatgctctacatatgagggaaa |
29235461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 212 - 281
Target Start/End: Original strand, 29348691 - 29348760
Alignment:
| Q |
212 |
gaatactcttctcttccttgaagatattgaaacaatttacaaatttaatttgctctacatatgagggaaa |
281 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||| || | |||||||||||||||||||| |
|
|
| T |
29348691 |
gaatactcttctcttccttgaggatattgaaacaatttacaaatctactatgctctacatatgagggaaa |
29348760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 100 - 142
Target Start/End: Complemental strand, 36675441 - 36675399
Alignment:
| Q |
100 |
acgggtgagtattgttccactgatcctttcttgcatatcccaa |
142 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36675441 |
acgggtgagtattgttccactgatcctttcttgcatatcccaa |
36675399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 100 - 142
Target Start/End: Complemental strand, 36685523 - 36685481
Alignment:
| Q |
100 |
acgggtgagtattgttccactgatcctttcttgcatatcccaa |
142 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36685523 |
acgggtgagtattgttccactgatcctttcttgcatatcccaa |
36685481 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University